primer design program version 3.0 Search Results


98
TaKaRa primers 50 tcggcttggttggccaggtggtctct 30
Primers 50 Tcggcttggttggccaggtggtctct 30, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers 50 tcggcttggttggccaggtggtctct 30/product/TaKaRa
Average 98 stars, based on 1 article reviews
primers 50 tcggcttggttggccaggtggtctct 30 - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

90
Illumina Inc adaptor overhang nucleotide sequences
Adaptor Overhang Nucleotide Sequences, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/adaptor overhang nucleotide sequences/product/Illumina Inc
Average 90 stars, based on 1 article reviews
adaptor overhang nucleotide sequences - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

86
Waters Corporation oasis prime hlb 30mg 96 well extraction plates
Oasis Prime Hlb 30mg 96 Well Extraction Plates, supplied by Waters Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oasis prime hlb 30mg 96 well extraction plates/product/Waters Corporation
Average 86 stars, based on 1 article reviews
oasis prime hlb 30mg 96 well extraction plates - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Eurofins primers p91
Primers P91, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers p91/product/Eurofins
Average 90 stars, based on 1 article reviews
primers p91 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
Bio-Rad master mix
Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/master mix/product/Bio-Rad
Average 96 stars, based on 1 article reviews
master mix - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

90
Illumina Inc primers ppho_con1f- illumina
Primers Ppho Con1f Illumina, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers ppho_con1f- illumina/product/Illumina Inc
Average 90 stars, based on 1 article reviews
primers ppho_con1f- illumina - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

99
OriGene cggttagcagtatgttgtccagc 30 origene n a primers
Cggttagcagtatgttgtccagc 30 Origene N A Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cggttagcagtatgttgtccagc 30 origene n a primers/product/OriGene
Average 99 stars, based on 1 article reviews
cggttagcagtatgttgtccagc 30 origene n a primers - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Illumina Inc sequencing adaptors
Sequencing Adaptors, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequencing adaptors/product/Illumina Inc
Average 90 stars, based on 1 article reviews
sequencing adaptors - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bioneer Corporation oligonucleotide primers
Oligonucleotide Primers, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotide primers/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
oligonucleotide primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega primer s-30
Primer S 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer s-30/product/Promega
Average 90 stars, based on 1 article reviews
primer s-30 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

86
Thermo Fisher prime rnase inhibitor
Prime Rnase Inhibitor, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prime rnase inhibitor/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
prime rnase inhibitor - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
5 PRIME pchap3909
Pchap3909, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pchap3909/product/5 PRIME
Average 90 stars, based on 1 article reviews
pchap3909 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results