98
|
TaKaRa
primers 50 tcggcttggttggccaggtggtctct 30 Primers 50 Tcggcttggttggccaggtggtctct 30, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers 50 tcggcttggttggccaggtggtctct 30/product/TaKaRa Average 98 stars, based on 1 article reviews
primers 50 tcggcttggttggccaggtggtctct 30 - by Bioz Stars,
2026-04
98/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
adaptor overhang nucleotide sequences Adaptor Overhang Nucleotide Sequences, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adaptor overhang nucleotide sequences/product/Illumina Inc Average 90 stars, based on 1 article reviews
adaptor overhang nucleotide sequences - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
86
|
Waters Corporation
oasis prime hlb 30mg 96 well extraction plates Oasis Prime Hlb 30mg 96 Well Extraction Plates, supplied by Waters Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oasis prime hlb 30mg 96 well extraction plates/product/Waters Corporation Average 86 stars, based on 1 article reviews
oasis prime hlb 30mg 96 well extraction plates - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Eurofins
primers p91 Primers P91, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers p91/product/Eurofins Average 90 stars, based on 1 article reviews
primers p91 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
96
|
Bio-Rad
master mix Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/master mix/product/Bio-Rad Average 96 stars, based on 1 article reviews
master mix - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
primers ppho_con1f- illumina Primers Ppho Con1f Illumina, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers ppho_con1f- illumina/product/Illumina Inc Average 90 stars, based on 1 article reviews
primers ppho_con1f- illumina - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
99
|
OriGene
cggttagcagtatgttgtccagc 30 origene n a primers Cggttagcagtatgttgtccagc 30 Origene N A Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cggttagcagtatgttgtccagc 30 origene n a primers/product/OriGene Average 99 stars, based on 1 article reviews
cggttagcagtatgttgtccagc 30 origene n a primers - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
sequencing adaptors Sequencing Adaptors, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequencing adaptors/product/Illumina Inc Average 90 stars, based on 1 article reviews
sequencing adaptors - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Bioneer Corporation
oligonucleotide primers Oligonucleotide Primers, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligonucleotide primers/product/Bioneer Corporation Average 90 stars, based on 1 article reviews
oligonucleotide primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
primer s-30 Primer S 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer s-30/product/Promega Average 90 stars, based on 1 article reviews
primer s-30 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
prime rnase inhibitor Prime Rnase Inhibitor, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prime rnase inhibitor/product/Thermo Fisher Average 86 stars, based on 1 article reviews
prime rnase inhibitor - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
5 PRIME
pchap3909 Pchap3909, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pchap3909/product/5 PRIME Average 90 stars, based on 1 article reviews
pchap3909 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |